View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_28 (Length: 262)
Name: NF9820_low_28
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 75 - 247
Target Start/End: Original strand, 35198121 - 35198293
Alignment:
| Q |
75 |
agttgctcaaatcttttctttaaaccatatatgagttgattaattatggttaattgaatggnnnnnnnactgtggaataaaatttgcccgtgaagtgatc |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
35198121 |
agttactcaaatcttttctttaaaccatatatgagttgattaattatggttaattgaaagatttttttactgtggaataaaatttgcccgtgaagtgatc |
35198220 |
T |
|
| Q |
175 |
attaacgtaccatggcatgtgtttcactctcgtgtggtctaatattgtttttggaatattacaagcattcatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35198221 |
attaacgtaccatggcatgtgtttcactctcgtgtggtttaatattgtttttggaatattacaagcattcatc |
35198293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 35198006 - 35198084
Alignment:
| Q |
1 |
aaaaccaacccaaactataaatgagtttatttaaaccannnnnnnnccttttaaaataacaaatattagtgattagttg |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| |
|
|
| T |
35198006 |
aaaaccaacccaaactataaatgagtttatttaaaccatttttttttcttttaaaatgacaaatgttagtgattagttg |
35198084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University