View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_32 (Length: 245)
Name: NF9820_low_32
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 26303899 - 26303673
Alignment:
| Q |
19 |
gttaagtcattaaaattggtggcgtgtcagttatgaaggtcaactagcttgttgatgtgtccttagggaccaaaatgaaagaaaataaaattcttcttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303899 |
gttaagtcattaaaattggtggcgtgtcaggtatgaaggtcaactagcttgttgatgtgtccttagggaccaaaatgaaagaaaataaaattcttcttca |
26303800 |
T |
 |
| Q |
119 |
tttcccaacaggtaccttcctcaactctctcactctttgctctgttgtttttatatatcatcataatgttttgctaagttccttccattttgaatctctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26303799 |
tttcccaacaggtaccttcctcaactctctcactctttgctctgttgtttttatatatcatcataatgttttgctaagttccttccattttgaatctctg |
26303700 |
T |
 |
| Q |
219 |
ttatgctatgtcctttgcttctccact |
245 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
26303699 |
ttatgctatgtcctttgattctccact |
26303673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University