View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_33 (Length: 238)
Name: NF9820_low_33
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32017695 - 32017902
Alignment:
| Q |
1 |
ttagatgtttgagttgttgtctagcaaagcgacagatgaagacaatacgttgatggaactattaccagattatgtatttgacagaaacgcgcaagacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32017695 |
ttagatgtttgagttgttgtctagcaaagcgacagatgaagacaatacatttatggaactattaccggattatgtatttgacagaaacgcgcaagacaag |
32017794 |
T |
|
| Q |
101 |
tttgtgtcgattcttaatcgattgcgaggctttagtacaaaagcatgcttttgaagacannnnnnnngctgactttcacgaatgaaaacttaatttgtta |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32017795 |
tttgtgtcgattcttgatcgattgcgaggctttag--------------tttgaagacattttttttgctgactttcacgaatgaaaacttaatttgtta |
32017880 |
T |
|
| Q |
201 |
caatttttatcctctcaattat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32017881 |
caatttttatcctctcaattat |
32017902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University