View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_34 (Length: 230)
Name: NF9820_low_34
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 98 - 230
Target Start/End: Original strand, 24714798 - 24714928
Alignment:
| Q |
98 |
tcttggtgccatt-agtgacattttgaaattaatactccttgtgcatacaagttggttgnnnnnnnnnnnnnnnacaaaagtttgttgggagtcttgatc |
196 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24714798 |
tcttggtgccattcagtgacattttgaaattaatactccttgtgcatacaaattggttg--cgattttttttttacaaaagtttgttggg-gtcttgatc |
24714894 |
T |
 |
| Q |
197 |
tcaacacattgggatccttattgcaactcattct |
230 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||| |
|
|
| T |
24714895 |
tcatcacattgggatccttatcgcaactcattct |
24714928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University