View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_36 (Length: 215)
Name: NF9820_low_36
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 4093584 - 4093490
Alignment:
| Q |
1 |
agatgcaccaaaccatgtgccaatatctctttgatttggagggagtaatgttggaaaaaactacctccaatgtaaataatatttgattttgagat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093584 |
agatgcaccaaaccatgtgccaatatctctttgatttggagggagtaatgttggaaaaaactacctccaatgtaaataatatttgattttgagat |
4093490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 93 - 183
Target Start/End: Complemental strand, 4093441 - 4093351
Alignment:
| Q |
93 |
gatggaacttttgtgacctcggcaaacagtcggccatgctttaagtcagatgcgttgtgtttaagtcgtatgaacggcatatctcttttta |
183 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
4093441 |
gatggaacttttgtgacctcggcaaatagtcggccatgctttaagtcagatgcgttgtgtttaagttgtatgaacggcatatctcctttta |
4093351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University