View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_37 (Length: 213)
Name: NF9820_low_37
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 30946147 - 30945967
Alignment:
| Q |
18 |
gtaggagcactagacgcaatgatgcttgcctaacgaatcaagctttcttatattaagggaaaaaccaggtgtgttcagatatttcttgaaacggtgttag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30946147 |
gtaggagcactagacgcaatgatgcttgcctaatgaatcaagctttcttatattaagggaaaaaccaggtgtgttcagatatttcttgaaacggttttag |
30946048 |
T |
|
| Q |
118 |
ctcgcttagagaaccaaatctcgcctagcgaaccacctttggcttttgttcttggaactctctattttggcttgctttcat |
198 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30946047 |
ctcgcttagcgaaccaaatctcgcctagtgaaccacctttggcttttgttcttggaactctctattttggcttgctttcat |
30945967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 30951894 - 30951714
Alignment:
| Q |
18 |
gtaggagcactagacgcaatgatgcttgcctaacgaatcaagctttcttatattaagggaaaaaccaggtgtgttcagatatttcttgaaacggtgttag |
117 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||||||||||| | ||||||||| ||| |||||||||| |||||||||||||| |||| |
|
|
| T |
30951894 |
gtaggagcgctagacgcagtgatgcttgcctagcgaatcaagctttcttatttggagggaaaaatcagtcgtgttcagatgtttcttgaaacggttttag |
30951795 |
T |
|
| Q |
118 |
ctcgcttagagaaccaaatctcgcctagcgaaccacctttggcttttgttcttggaactctctattttggcttgctttcat |
198 |
Q |
| |
|
||| ||||| |||||||||||| | | ||||||||||||||||||| | ||||||||||||||||| |||| ||||||| |
|
|
| T |
30951794 |
ctctcttagcgaaccaaatctcatccaacgaaccacctttggcttttctccttggaactctctatttaggctcactttcat |
30951714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 197
Target Start/End: Original strand, 22182163 - 22182230
Alignment:
| Q |
130 |
accaaatctcgcctagcgaaccacctttggcttttgttcttggaactctctattttggcttgctttca |
197 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| | ||||||||||| |||| ||| ||||||| |
|
|
| T |
22182163 |
accaaatctcgcttagcgaaccaccattggcttttccttctggaactctctgtttttgctcgctttca |
22182230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 197
Target Start/End: Original strand, 12830984 - 12831108
Alignment:
| Q |
73 |
agggaaaaaccaggtgtgttcagatattt-cttgaaacggtgttagctcgcttagagaaccaaatctcgcctagcgaaccacctttggcttttgttcttg |
171 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||| || | |||| || |||| | |||||||||||||||||||| || |||||||| | ||| |
|
|
| T |
12830984 |
agggaaaaaccagttgacttcagatattttcttgaaccgat-ttagttctcttaacggaccaaatctcgcctagcgaaatgtctctggcttttccttttg |
12831082 |
T |
|
| Q |
172 |
gaactctctattttggcttgctttca |
197 |
Q |
| |
|
||||||||| |||||| ||||||||| |
|
|
| T |
12831083 |
gaactctctgttttggattgctttca |
12831108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University