View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9820_low_38 (Length: 202)
Name: NF9820_low_38
Description: NF9820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9820_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 27215264 - 27215373
Alignment:
| Q |
1 |
ctggactttctcttgtttgactgcaaaatgcaaattcattatttaaaaggaggtgcgaaattaaatgaaactgaacagtcgatgcaaaatcagcacaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27215264 |
ctggactttctcttgtttgactgcaaaatgcaaattcattatttaaaaggaggtgcgaaattaaatgaaactgaacagtcgatgcaaaatcagcacaccc |
27215363 |
T |
 |
| Q |
101 |
ctatgcttct |
110 |
Q |
| |
|
||||| |||| |
|
|
| T |
27215364 |
ctatgattct |
27215373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 27236867 - 27236976
Alignment:
| Q |
1 |
ctggactttctcttgtttgactgcaaaatgcaaattcattatttaaaaggaggtgcgaaattaaatgaaactgaacagtcgatgcaaaatcagcacaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27236867 |
ctggactttctcttgtttgactgcaaaatgcaaattcattatttaaaaggaggtgcgaaattaaatgaaactgaacagtcgatgcaaaatcagcacaccc |
27236966 |
T |
 |
| Q |
101 |
ctatgcttct |
110 |
Q |
| |
|
||||| |||| |
|
|
| T |
27236967 |
ctatgattct |
27236976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University