View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9821_high_19 (Length: 229)
Name: NF9821_high_19
Description: NF9821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9821_high_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 40746202 - 40746421
Alignment:
| Q |
10 |
gtttgtccatttgttttgttgaagtggctctttcttttatcttaatctgtcgaacgtgttgcatatgtgtaccaaattgttactttactagtattgtgac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40746202 |
gtttgtccatttgttttgttgaagtggctctttcttttatctatatctgtcgaacgtgttgcatatgcgtaccaaattgttactttactagtattgtgac |
40746301 |
T |
 |
| Q |
110 |
atgtcttataccaggggcaacttgacatcagcacttttggataacatgaaaattaggtgttaaatcaatttaacatggaggaaaaaatatttaggctaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40746302 |
atgtcttataccaggggcaacttgacatcagcacttttggataacatgaaaattaggtgttaaatcaatttaacatggaggaaaaaatatttaggctaat |
40746401 |
T |
 |
| Q |
210 |
ttgtagttgctgcaaagggc |
229 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
40746402 |
ttgtagttgctttaaagggc |
40746421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University