View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9821_low_12 (Length: 332)
Name: NF9821_low_12
Description: NF9821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9821_low_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 44897344 - 44897672
Alignment:
| Q |
1 |
tttggtgattcgtttgtgagaactgcttcaaatcatctgaggaaagtttctcaggagttgactcgtttaacttctttttcaaaacaagttggagttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44897344 |
tttggtgattcgtttgtgagaactgcttcaaatcatctgaggaaagtttctcaggagttgactcgtttaacttctttttcaaaacaagttggagttgaaa |
44897443 |
T |
 |
| Q |
101 |
aggtgaagcatgctaggactgattctgtagcttctcatgctctccgggaattcaggtttatcactaagaatgatggtgatgctggatgggaaacggttga |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44897444 |
aagtgaagcatgctaggactgattctgtagcttctcatgctctccgggaattcaggtttatcactaagaatgatggtgatgctggatgggaaacggttga |
44897543 |
T |
 |
| Q |
201 |
gaaaaagtttgataagcttgctgacaaaaacgggttacttcatcgtgacaattttgccaaatgcataggtactgcttaatacaaatcaattttctaatca |
300 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44897544 |
gaaaaagtttgataagcttgctgac---aacgggttacttcatcgtgacaactttgccgaatgcataggtactgcttaatacatatcaattttctaatca |
44897640 |
T |
 |
| Q |
301 |
tttgaattaacttatttatttctatctattaa |
332 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
44897641 |
tttcaattaacttatttatttctatctattaa |
44897672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University