View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9821_low_18 (Length: 253)
Name: NF9821_low_18
Description: NF9821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9821_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 20 - 140
Target Start/End: Original strand, 38043908 - 38044028
Alignment:
| Q |
20 |
atgtataacataaagatcttattcatcaataatactatatatttaggtgatgctaaatcacataaagatcttgttactgtttttgttataaagtagcatt |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38043908 |
atgtataacataaagatctgtttcatcaataatactatatatttaggagatgctaaatcacataaagatcttgttactgtttttgttataaagtagcatt |
38044007 |
T |
 |
| Q |
120 |
aatttcttgcatatcgaatga |
140 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38044008 |
aatttcttgcatatcgaatga |
38044028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 220
Target Start/End: Original strand, 38045851 - 38045890
Alignment:
| Q |
181 |
atttatgatgggtggatcacaacgttataatcttgtgatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38045851 |
atttatgatgggtggatcacaacgttataatcttgtgatt |
38045890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University