View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9822_high_4 (Length: 255)

Name: NF9822_high_4
Description: NF9822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9822_high_4
NF9822_high_4
[»] chr5 (1 HSPs)
chr5 (106-237)||(29306496-29306624)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 106 - 237
Target Start/End: Original strand, 29306496 - 29306624
Alignment:
106 taaaaaatttagagttcttcacattagtattccagccggcgtaaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac 205  Q
    ||||||||||||||||||||||||||||||| ||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29306496 taaaaaatttagagttcttcacattagtattgcagccg---taaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac 29306592  T
206 gcaactgcgatcacagttgctgttttgatctc 237  Q
    ||||||||||||||||||||||||||||||||    
29306593 gcaactgcgatcacagttgctgttttgatctc 29306624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University