View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9822_high_5 (Length: 250)
Name: NF9822_high_5
Description: NF9822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9822_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 250
Target Start/End: Complemental strand, 41028144 - 41027909
Alignment:
| Q |
15 |
tgagggaggaacttcgtctctcagttgtgagttccttaacttctccgatagagtggtagttgtggttgttttgagtttttgagctatagcaagaaatgca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41028144 |
tgagggaggaacttcgtctctcagttgtgagttccttaacttctccgatagagtggtagttgtggttgttttgagtttttgagctatagcaagaaatgca |
41028045 |
T |
 |
| Q |
115 |
tacaaggtaaagtgataaaaatagcttgtttgattgatcatatgtatctattaaagtgtatgcccttggtatttataacagaaaccatgcatattagcca |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41028044 |
tacaaggtaaagtgataaaaatagtttgtttgattgatcatatgtatctattaaagtgtatgcccttggtatttataccagaaaccatgcatattagcca |
41027945 |
T |
 |
| Q |
215 |
aacgacatggcctgacgtgacgaacccttgttcgac |
250 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
41027944 |
aacgacatgacctgacgtgacgaacccttgctcgac |
41027909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 21720544 - 21720494
Alignment:
| Q |
9 |
tggtgttgagggaggaacttcgtctctcagttgtgagttccttaacttctc |
59 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||| ||||||||||| |
|
|
| T |
21720544 |
tggtgttgagagaggaattttgtttctcagttgtgagtttcttaacttctc |
21720494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University