View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9822_low_6 (Length: 255)
Name: NF9822_low_6
Description: NF9822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9822_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 106 - 237
Target Start/End: Original strand, 29306496 - 29306624
Alignment:
| Q |
106 |
taaaaaatttagagttcttcacattagtattccagccggcgtaaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29306496 |
taaaaaatttagagttcttcacattagtattgcagccg---taaatgtggctcatcggccatatttgtctgcattttgccgcaatataaaggcttacaac |
29306592 |
T |
 |
| Q |
206 |
gcaactgcgatcacagttgctgttttgatctc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29306593 |
gcaactgcgatcacagttgctgttttgatctc |
29306624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University