View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9825_low_4 (Length: 240)
Name: NF9825_low_4
Description: NF9825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9825_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 50 - 225
Target Start/End: Original strand, 48251478 - 48251658
Alignment:
| Q |
50 |
aaacaattaatgtaattacactcaacg-----gtgttgtgtcggacaccaaacacataagtgttggtgctaatcttctctttggcagcattgatgtcttt |
144 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251478 |
aaacaattaatgtaattacactcatcggtgttgtgttgtgtcggacaccaaacacataagtgtcggtgctaatcttctctttggcagcattgatgtcttt |
48251577 |
T |
|
| Q |
145 |
tacagctttactaacaaagtagaagtaatactatccatttgtcattatcagtgggatgcgcttgaaaacaagtccacagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48251578 |
tacagctttactaacaaagtagaagtaatactaaccatttgtcattatcagtgggatgcgcttgaaaacaagtccacagtg |
48251658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University