View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9825_low_5 (Length: 227)
Name: NF9825_low_5
Description: NF9825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9825_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 212
Target Start/End: Original strand, 43076212 - 43076414
Alignment:
| Q |
10 |
agtgagatgaaccaaaacaaaaaatattaaaagaacaattttatgaacaaaaagtgcaacatgtcccgtgcctgtggtttagaatttagattgttcatct |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43076212 |
agtgacatgaaccaaaacaaaaaatattaaaagaacaattttatgaacaaaaagtgcaacatgtcctgtgcctgtggtttagaatttagattgttcatct |
43076311 |
T |
|
| Q |
110 |
ctcttaatttctttgaacatatatcaatagatgcaatgcacccgtgacctatctatctatctctctgtaaatgattctctgattcagcttcagttaatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43076312 |
ctcttaatttctttgaacatatatcaatagatgcaatgcacccgtgacctatctatctatctctctgtaaatgattctctgattcagcttcacttaatat |
43076411 |
T |
|
| Q |
210 |
atg |
212 |
Q |
| |
|
||| |
|
|
| T |
43076412 |
atg |
43076414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University