View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_high_20 (Length: 341)
Name: NF9826_high_20
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 44 - 214
Target Start/End: Complemental strand, 4610966 - 4610796
Alignment:
| Q |
44 |
ggctcgcgatacacattagaaattcgtattgattcgatctagttctgcattgaaatgagatatgaatggcgtgtatcgtaaggtactgataacaattgct |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||| || | || ||||||||||||||||||||||||||||| |
|
|
| T |
4610966 |
ggctcgcgatacacactagaaattcgtattgatttgatccagttttgcattgaaatgagatacgagtcgcatgtatcgtaaggtactgataacaattgct |
4610867 |
T |
|
| Q |
144 |
atgagtacagagttgtattctttaaaagaaaccaaaccaaattctttactagatgtaaaccacttggttac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610866 |
atgagtacagagttgtattctttaaaagaaaccaaaccaaattctttactagatgtaaaccacttggttac |
4610796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 4611036 - 4610997
Alignment:
| Q |
1 |
ttgacaaaggaaaccattagaatgaatcatgatttaccat |
40 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
4611036 |
ttgacaaaggaaaccattaaaataaatcatgatttaccat |
4610997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University