View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_high_21 (Length: 335)
Name: NF9826_high_21
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 64 - 327
Target Start/End: Complemental strand, 24199352 - 24199089
Alignment:
| Q |
64 |
taaacatatcacactatgttttatacatcgagagaaggtgacattctcttgcaatactatccaagtagaaaaccatgcaaacatgaatgaacattgaaat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24199352 |
taaacatatcacactatgttttatacatcgacagaaggtgacattctcttgcaatattatccaggtagaaaaccatgcaaacatgaatgaacattgaaat |
24199253 |
T |
 |
| Q |
164 |
cacatttaacagaatttttacctgagactactggacttattatcaacagaatcatggttttcatctacaggaacttgtgatgaaggttgcatttcggaca |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24199252 |
cacatttaacagaatttttacctgagactactggacttattatcaacagaatcatggttttcatctacaggaacttgtgatgaaggttgcatttcggaca |
24199153 |
T |
 |
| Q |
264 |
agttgagcataaccattgagctcgatggaacaagtgcagctatatcaggaggctgatctctgct |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
24199152 |
agttgagcataaccattgagctcgatggaactagtgcagctatatcaggaggctgatctttgct |
24199089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University