View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_high_26 (Length: 308)
Name: NF9826_high_26
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 24605202 - 24604977
Alignment:
| Q |
7 |
gcagcagagacaaaacacatacatgcccattatggcttcttgtctcgatttcaaatttcaaaaataaattcgatggtcttttttacttttgttacatgca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605202 |
gcagcagagacaaaacacatacatgcccattatggcttcttgtctcgatttcaaatttcaaaaataaattcgatggtcttttttacttttgttacatgca |
24605103 |
T |
 |
| Q |
107 |
cacaatgaaaagttcatttactagagtgtgtgaataaaaagactagtgtaggttggaattcgtgaaagatgtttatatttagtgtctaacggtccttcga |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
24605102 |
cacaatgaaaagttcatttactagattgtgtgaagaaaaagactggtgtaggttggaattcgtgaaagatgtctatatttagtgtctaacagtccttcga |
24605003 |
T |
 |
| Q |
207 |
ataagattatttaaggtggagagaat |
232 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
24605002 |
ataagattatttatggtggagagaat |
24604977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 24604952 - 24604912
Alignment:
| Q |
255 |
taaattaagtttgcgaatatgtttggatgataatattttat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24604952 |
taaattaagtttgcgaatatgtttggatgataaaattttat |
24604912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University