View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_high_28 (Length: 276)
Name: NF9826_high_28
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 46557570 - 46557302
Alignment:
| Q |
1 |
ataccaaaattaaccttaaagcct---tgttcttaattagtaacctcctctctttctctttctaaacatcgctcttgtttcttttcacttcccaatggaa |
97 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557570 |
ataccaaaattaaccttaaagcctccttgttcttaattagtaacctcctctctttctctttctaaacatcgctcttgtttcttttcacttcccaatggaa |
46557471 |
T |
 |
| Q |
98 |
gcaacagaaacaagacccgaactagtagttgttcaagaagcaccaccacctctaccaccagaagaacaacaattacaacctctcatgtgcaaggtaaatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557470 |
gcaacagaaacaagacccgaactagtagttgttcaagaagcaccaccacctctaccaccagaagaacaacaattacaacctctcatgtgcaaggtaaatc |
46557371 |
T |
 |
| Q |
198 |
aaacattcattcattcctctgcatgcggttttaataactctcttttactacttctaacatacgtctctg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46557370 |
aaacattcattcattcctctgcatgcggttttaataactctcttttactacttctaacatacgtctctg |
46557302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University