View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_high_35 (Length: 239)
Name: NF9826_high_35
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 158 - 224
Target Start/End: Original strand, 24479013 - 24479079
Alignment:
| Q |
158 |
ggaactaacaggtcaagaacggagatgtatttgagagtagaataaacggattcgggatcgtcacggt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24479013 |
ggaactaacaggtcaagaacggagatgtatttgagagtagaataaacggattcgggatcgtcacggt |
24479079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 158 - 224
Target Start/End: Original strand, 24460850 - 24460916
Alignment:
| Q |
158 |
ggaactaacaggtcaagaacggagatgtatttgagagtagaataaacggattcgggatcgtcacggt |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24460850 |
ggaactaacatgtcaagaacggagatgtatttgagagtagaataaacggattcgggatcatcacggt |
24460916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University