View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_low_24 (Length: 317)
Name: NF9826_low_24
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 31167141 - 31166857
Alignment:
| Q |
16 |
tgtttcatttgcttcagctgcagagaatcattaccatcagtttgttgtaagtgtttgtttgatgatcattgatcgcatatatgtttgtaccaatttgcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31167141 |
tgtttcatttgcttcagctgcagagaatcattaccatcagtttgttgtaagtgtttgtttgatgatcattgatcacatatatgtttgtaccaatttgcaa |
31167042 |
T |
|
| Q |
116 |
ctgtgttaactaacttcaatggttgatggaaatagattcaaactgcaacagtgaagaggctgtgcaaaactcgaaggatactcacggtaaatggacagtt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31167041 |
ctgtattaactaacttcaatggttgatggaaatagattcaaactgcaacagtgaagaggctgtgcaaaactcgaaggatactcacggtaaatggacagtt |
31166942 |
T |
|
| Q |
216 |
tcctggcccaacaatcgtagcaagagacggagattctatggtgatcaaagtaacaaatgctggaccttacaacatctccatccac |
300 |
Q |
| |
|
|||||| ||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166941 |
tcctggtccaacgatcgaagctagagacggagattctatggtgatcaaagtaacaaatgctggaccttacaacatctccatccac |
31166857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University