View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_low_38 (Length: 246)
Name: NF9826_low_38
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_low_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 23 - 246
Target Start/End: Complemental strand, 4207656 - 4207433
Alignment:
| Q |
23 |
acctttgtcatcttgttgttataacttataaggaactttttcagagatacctttctcacgaagcatgttatatttgcgcaatttctccgcgtataaattg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4207656 |
acctttgtcatcttgttgttataacttataaggacctttttcagagatacctttctcacgaagcatgttatatttgcgcaatttctccgcgtataaattg |
4207557 |
T |
 |
| Q |
123 |
gattgtcaggaatcttgtatactaccaaaaataaaatataaggaatcttgtatatttcttattttaagtttaaattaaaatatccttgaaaaaataagtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4207556 |
gattgtcaggaatcttgtatactaccaaaaataaaatataaggaatcttgtatatttcttattttaaatttaaattaaaatatccttgaaaaaataagtt |
4207457 |
T |
 |
| Q |
223 |
taatgtgaaataaaaatgcaatac |
246 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4207456 |
taatgtgaaataaaaatgcaatac |
4207433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University