View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_low_39 (Length: 239)
Name: NF9826_low_39
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 36227853 - 36228055
Alignment:
| Q |
21 |
cttatgaaattgtcataactcataagctgttttcaaaagtttgaactcaattcgtcctgaaggatttgtccttaattgcagctcattaacgacagaggcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36227853 |
cttatgaaattgtcataactcataagctgtgttcaaaagtttgaactcaattcgtcctgaaggatttgtccttaattgcagctcattaaccacagaggcc |
36227952 |
T |
 |
| Q |
121 |
aatcacttagttacaagttgaagtgtttaacaaggaattaagctcggtaaaatcatgaatggaactattggcaaacacttctaccattgaagcatatgaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36227953 |
aatcacttagttacaagttgaagtgtttaacaaggaattaagctcggtaaaatcatgaatggaactattggcaaacacttctaccattgaagcatatgaa |
36228052 |
T |
 |
| Q |
221 |
aat |
223 |
Q |
| |
|
||| |
|
|
| T |
36228053 |
aat |
36228055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University