View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9826_low_41 (Length: 238)
Name: NF9826_low_41
Description: NF9826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9826_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 894024 - 894251
Alignment:
| Q |
1 |
tttagtgtggcctatttttgttccaaaaaataccctcaacttgaaaagacacaggtggaaaataggggtggttatcttttttactctttaaaaatcaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894024 |
tttagtgtggcctatttttgttccaaaaaataccctcaacttgaaaagacacaggtggaaaataggggtggttatcttttttactctttaaaaatcaagc |
894123 |
T |
 |
| Q |
101 |
ggttccattgttttgctagaggnnnnnnnntaacatagaatcacagtaactgacataggaaatggagatacatgacaatctaatatagaaaattttaag- |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894124 |
ggttccattgttttgctagaggaaaaaaaataacatagaatcacagtaactgacataggaaatggagatacatgacaatctaatatagaaaattttaaga |
894223 |
T |
 |
| Q |
200 |
----aatataattgatgttagtaaaata |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
894224 |
atataatataattgatgttagtaaaata |
894251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University