View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9827_low_4 (Length: 211)
Name: NF9827_low_4
Description: NF9827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9827_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 9 - 156
Target Start/End: Complemental strand, 8444255 - 8444109
Alignment:
| Q |
9 |
tagctggtcatttggtttgtttactagctagtgttctattgnnnnnnnncttggtgctcggtttgtattttatcgtgtaattacagttgaggcctagcat |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8444255 |
tagctggtgatttggtttgtttactagctagtgttctattgttttttt-cttggtgcttggtttgtattttatcgtgtaattacagttgagtcctagcat |
8444157 |
T |
 |
| Q |
109 |
tgcactctttgtgcatttttggatctctttttggtttgatataattca |
156 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
8444156 |
tgcactctttgtgcatgtttggatctctttttggtttcatataattca |
8444109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University