View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9828_high_16 (Length: 229)
Name: NF9828_high_16
Description: NF9828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9828_high_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 229
Target Start/End: Original strand, 48492272 - 48492499
Alignment:
| Q |
2 |
caacgtgattgggaggataaggtgctctgtcacgtaaagctttgtaagcctcaatcaccaaaacaacttcattagctgacttggctagtccatattgttg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48492272 |
caacgtgattgggaggataaggtgctctgtcacgtaaagctttgtaagcctcaatcaccaaaacaacttcattagctgacttggctagtccatattgttg |
48492371 |
T |
 |
| Q |
102 |
ccttaatctccctaaattgtctagagctccctcaaacatgcagaatatctcatcttttacaccaaacattctgccatattccattcaataagatgataaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48492372 |
ccttaatctccctaaattgtctagagctccctcaaacatgcagaatatctcatcttttacaccaaacattctgccattttccattcaataagatgataaa |
48492471 |
T |
 |
| Q |
202 |
gaaactactaaaaatagggtgctgccta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48492472 |
gaaactactaaaaatagggtgctgccta |
48492499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 34 - 155
Target Start/End: Complemental strand, 7795003 - 7794882
Alignment:
| Q |
34 |
cgtaaagctttgtaagcctcaatcaccaaaacaacttcattagctgacttggctagtccatattgttgccttaatctccctaaattgtctagagctccct |
133 |
Q |
| |
|
||||||||||||||||||||||||| | ||| |||||||| || || || | ||||||||||| || || || ||||||||||||||||||| ||| | |
|
|
| T |
7795003 |
cgtaaagctttgtaagcctcaatcataagaactacttcatttgcagattttgaaagtccatattgctgtctcaagctccctaaattgtctagagatcctt |
7794904 |
T |
 |
| Q |
134 |
caaacatgcagaatatctcatc |
155 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
7794903 |
caaacaagcagaatatctcatc |
7794882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University