View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9828_low_13 (Length: 258)
Name: NF9828_low_13
Description: NF9828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9828_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 43805549 - 43805301
Alignment:
| Q |
1 |
tattctttaatcgttgttgcatatgttaacgttaaatcttaatgtctatcaccttcattactgtgtctttttgccaatccttaactgtcattaatatttt |
100 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805549 |
tattcttcaatcattgttgcatatgttaacgttaaatcttaatgtctatcaccttcattactgtgtctttttgccaatccttaactgtcattaatatttt |
43805450 |
T |
 |
| Q |
101 |
gcatttcattttcttaatttgggatttcattgttgctttttgttcataaggtagatacataatggggctacttttgttaaggttgataagattttaaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43805449 |
gcatttcattttcttaatttgggatttcattgttgacttttgttcataaggtagatacataatggggctacttttgttaaggttgataagattttaaatc |
43805350 |
T |
 |
| Q |
201 |
cgaaggatggaagtccagcattgttgattcaaggtatattgcctatgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43805349 |
cgaaggatggaagtccagcattgttgattcaaggtatattgcttatgct |
43805301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University