View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9828_low_15 (Length: 248)
Name: NF9828_low_15
Description: NF9828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9828_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 9714071 - 9713833
Alignment:
| Q |
1 |
atatttaagtctatgatttatatgtaggtgagttcttaggcggaccgcttcataagcagtcgaccatagatcagtcattaaaattattagaaatttcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9714071 |
atatttaagtctatgatttatatgtaggtgagttcttaggcggaccgcttcataagcagtcgaccatagatcagtcattaaaattattagaaatttcaac |
9713972 |
T |
|
| Q |
101 |
gatcatcgacgatactatattagaaataaatgagctatttacatattagtacggttaatttcacgacccttatatttacagttaatttggtgacttatag |
200 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9713971 |
gaccatcgacgatactacattagaaataaatgagttatctacatatcagtacggttaattttacgacccttatatttatagttaatttggtgacttatag |
9713872 |
T |
|
| Q |
201 |
atatcggttcaatacgaactacatatttattttcctttg |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9713871 |
atgtcggttcaatacgaactacatatttattttcctttg |
9713833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 16952611 - 16952563
Alignment:
| Q |
188 |
tggtgactt-atagatatcggttcaatacgaactacatatttattttcc |
235 |
Q |
| |
|
||||||||| || ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
16952611 |
tggtgacttgattgatatcggttcaataggagctacatatttattttcc |
16952563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University