View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9828_low_17 (Length: 240)
Name: NF9828_low_17
Description: NF9828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9828_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 13753299 - 13753520
Alignment:
| Q |
8 |
acaatggttttgagaaacacaacgcagtacctaacaggttattagtctttcaacaaactttatattatcggtacaaatagaccagtaaatatgatcagaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13753299 |
acaatggttttgagaaacacaacgcagtacctaacaggttattagtctttcaacaaactttatattatcagtacaaatagaccagtaaatatgatcagaa |
13753398 |
T |
|
| Q |
108 |
gttaattgaggagggggatgctttgaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaagattggaaatcatt |
207 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13753399 |
gttatttgagga-ggggatgctttgaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaagattggaaatcatt |
13753497 |
T |
|
| Q |
208 |
atggaatttgtatggtgcctttg |
230 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
13753498 |
atggaatttgtatcgtgcctttg |
13753520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University