View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9828_low_18 (Length: 240)
Name: NF9828_low_18
Description: NF9828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9828_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 27 - 223
Target Start/End: Original strand, 9714126 - 9714322
Alignment:
| Q |
27 |
gtttggtattggtctctacactttcataatatcgtttgtaatctctctatgtgataaagacttgttaattaactgtctcatgctcgcaaaataaatcaac |
126 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9714126 |
gtttggtattcgtccctacactttcataatatcgtttgcaatctctctatgtgataaagacttgttaattaactgtctcatgctcgcaaaaaaaatcaac |
9714225 |
T |
 |
| Q |
127 |
tgtgccatgtttgctacaaatacctctgtagtaatgacccggggtttcatcttccatgactttgatggagtatgatgcagttcctgatactaaggaa |
223 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
9714226 |
tgtcccatgtttgctacaaatacctctgtagtaatgacccggggtttcatcttccatgactttgatggagtatgatgcagttcctgatgccaaggaa |
9714322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University