View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_high_13 (Length: 264)
Name: NF9829_high_13
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 33985499 - 33985723
Alignment:
| Q |
18 |
aatgggttgtgtgtgcatccaagtcttgctaatcgaatactcaccaccatttttcacctgcaagtaacaataacatcataattcaagaacaaggaaaccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985499 |
aatgggttgtgtgtgcatccaagtcttgctaatcgaatactcaccaccatttttcacctgcaagtaacaataacatcataattcaagaacaaggaaaccc |
33985598 |
T |
|
| Q |
118 |
agaattcgaatgaacaataacatattaaactatttttcagtgttttgaaattgaagaaaaggttgagaaggaagagagaagaaacgaacctggctggttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33985599 |
agaattcgaatgaacaataacatattaaactatttttgagtgttttgaaattgaagaaaaggttgagaaggaagagagaagaaacgaacctggctggttg |
33985698 |
T |
|
| Q |
218 |
ggttcgaaggaacaatgaatgaatg |
242 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
33985699 |
ggttcgatggaacaatgaatgaatg |
33985723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University