View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_high_21 (Length: 227)
Name: NF9829_high_21
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 28894495 - 28894711
Alignment:
| Q |
1 |
tagacgcgctaaattattagagaccacttccattttatatctgtctaattttcgtcgatggtttaactttttgtctagtatgaattattggctacccaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28894495 |
tagacgcgctaaattattagagaccacttccattttatatctgtctaattttcgtcgatggttcaactttttttctagtatgaattattggctacccaag |
28894594 |
T |
 |
| Q |
101 |
aatcagaagtaggaggaatcccttgatcaacattgagtttgctgagagcttgaattataagatcatgaagagatttttgaggtgattcaatttgagagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28894595 |
aatcagaagtaggaggaatcccttgatcaacattgagtttgctgagagcttgaattataagatcatgaagagatttttgaggtgattcaatttgagagaa |
28894694 |
T |
 |
| Q |
201 |
tatggaaactatctctg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28894695 |
tatggaaactatctctg |
28894711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 93 - 138
Target Start/End: Complemental strand, 55098167 - 55098122
Alignment:
| Q |
93 |
tacccaagaatcagaagtaggaggaatcccttgatcaacattgagt |
138 |
Q |
| |
|
|||||||||||| || ||||||||||| ||| |||||||||||||| |
|
|
| T |
55098167 |
tacccaagaatctgatgtaggaggaattcctcgatcaacattgagt |
55098122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University