View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_low_12 (Length: 353)
Name: NF9829_low_12
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 515783 - 516103
Alignment:
| Q |
18 |
ctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatcttggtcctttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515783 |
ctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatcttggtcctttaa |
515882 |
T |
|
| Q |
118 |
tgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgttcataggatttcaacatcatgagatccttgtctctgcaaatgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515883 |
tgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgttcataggatttcaacatcatgagatccttgtctctgcaaatgga |
515982 |
T |
|
| Q |
218 |
ggtattccatttgaagctggtgactttccctcttctgttggaaatgggacaaccttagtaggaagttctcttccagatttggaaacctccatcgacacag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515983 |
ggtattccatttgaagctggtgactttccctcttctgttggaaatgggacaaccttagtaggaagttctcttccagatttggaaacctccatcgacacag |
516082 |
T |
|
| Q |
318 |
ccaatgatttgtctcaaattc |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
516083 |
ccaatgatttgtctcaaattc |
516103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University