View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_low_24 (Length: 246)
Name: NF9829_low_24
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 4906838 - 4907053
Alignment:
| Q |
14 |
caaaggagtaaacgtcagatttatctgtgaaagtgttggttaggacatactttgcggccatgtaacctaatgttataaagagaataaagatccaatttgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4906838 |
caaaggagtaaacgtcagatttatctgtgaaagtgttggttaggacatactttgctgccatgtaacctaatgttataaagagaataaagactcaatttgt |
4906937 |
T |
 |
| Q |
114 |
tccattgcaatttgtttgcagcccaattcagtccctgatgaaaaaataataccctagtctttggcattatcatactgggacaaattatcccctatgttat |
213 |
Q |
| |
|
||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4906938 |
tccctcacaatttgtttgtagcccaattcagtccctgatgaaaaaataataccctagtctttggcattatcatactgggacaaattatcccctatgttat |
4907037 |
T |
 |
| Q |
214 |
attggcccattataac |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4907038 |
attggcccattataac |
4907053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 78
Target Start/End: Complemental strand, 5822802 - 5822738
Alignment:
| Q |
14 |
caaaggagtaaacgtcagatttatctgtgaaagtgttggttaggacatactttgcggccatgtaa |
78 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||||| ||||||||| || ||||||||| |
|
|
| T |
5822802 |
caaaggagtaaacatcacatttatctgtgaaagtattggttcggacatactctggtgccatgtaa |
5822738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University