View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_low_25 (Length: 243)
Name: NF9829_low_25
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 1553627 - 1553847
Alignment:
| Q |
6 |
tttggtgttgatccactaggccttggcaaggacccagcatttctgaaatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttc |
105 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553627 |
tttggttttgacccactaggccttggcaaggacccagcatttctgaaatggtacagagaagctgagcttattcatggaaggtgggcaatggctgcagttc |
1553726 |
T |
 |
| Q |
106 |
taggcatctttgttggtcaagcatggagtggagttccatggtttgaggctggagctgaccccaatgcaattgctccattctcctttggtactcttctagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1553727 |
taggcatctttgttggtcaagcatggagtggagttccatggtttgaggctggagctgaccccaatgcaattgctccattctcctttggtactcttctagg |
1553826 |
T |
 |
| Q |
206 |
cactcagttgattctcatggg |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1553827 |
cactcagttgattctcatggg |
1553847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University