View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_low_28 (Length: 234)
Name: NF9829_low_28
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_low_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 3 - 234
Target Start/End: Original strand, 30395170 - 30395400
Alignment:
| Q |
3 |
gttcggctcttcaacaacaattaactgtcgttcggcattttctatagcaattcaatcannnnnnnaatcggtttaaacgatcttatagtgtaacgacagt |
102 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30395170 |
gttcggctct-caacaacagttaaccgtcgttcggcattttctataacaattcaatcatttttttaatcggtttaaacgatcttatagtgtaacgacagt |
30395268 |
T |
 |
| Q |
103 |
taacccccactggatagccgaacagtatttaactgtctctcggtcaacaagagttgcaaaaaagagaaattcgcctcaagaaaaacttgtttaggcttgt |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30395269 |
taacccccactggatagccgaacggtatttaactgcctcttggtcaacaagagttgcaaaaaagagaaattcgcctcaagacaaacttgtttaggcttgt |
30395368 |
T |
 |
| Q |
203 |
gctactttaagcctcatagtccctgtttgtct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30395369 |
gctactttaagcctcatagtccctgtttgtct |
30395400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University