View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9829_low_35 (Length: 207)

Name: NF9829_low_35
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9829_low_35
NF9829_low_35
[»] chr1 (2 HSPs)
chr1 (11-70)||(42177824-42177883)
chr1 (139-190)||(42177701-42177752)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 70
Target Start/End: Complemental strand, 42177883 - 42177824
Alignment:
11 aagcagagatcaaatggaaaagaacaaagaatgattcacatcgacgattgaaatgggaag 70  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42177883 aagcaaagatcaaatggaaaagaacaaagaatgattcacatcgacgattgaaatgggaag 42177824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 42177752 - 42177701
Alignment:
139 taatcaagagttgaattttcttgaagcataatcgtagttcgaggaagaaacc 190  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||    
42177752 taatcaagagttgaattttcttgaagcataattgtagttcgaggaagaaacc 42177701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University