View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9829_low_35 (Length: 207)
Name: NF9829_low_35
Description: NF9829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9829_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 70
Target Start/End: Complemental strand, 42177883 - 42177824
Alignment:
| Q |
11 |
aagcagagatcaaatggaaaagaacaaagaatgattcacatcgacgattgaaatgggaag |
70 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177883 |
aagcaaagatcaaatggaaaagaacaaagaatgattcacatcgacgattgaaatgggaag |
42177824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 42177752 - 42177701
Alignment:
| Q |
139 |
taatcaagagttgaattttcttgaagcataatcgtagttcgaggaagaaacc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42177752 |
taatcaagagttgaattttcttgaagcataattgtagttcgaggaagaaacc |
42177701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University