View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9830_low_12 (Length: 304)
Name: NF9830_low_12
Description: NF9830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9830_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 109 - 285
Target Start/End: Complemental strand, 1453307 - 1453129
Alignment:
| Q |
109 |
agaaagagtgtccatatatgagagtgagaggaagacat--caaccgtattattaaaatgaacggatgagattaaatgatcatcacgtgctcctctattca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1453307 |
agaaagagtgtccatatatgagagtgagaggaagacatatcaaccgtatgattaaaatgaagggatgagattaaatgatcatcacgtgctcctcttttca |
1453208 |
T |
 |
| Q |
207 |
atcactttacacaaacttgcagaactcgtctttgtttcaagtcatctaaccggatgccgcatcgaactcatctcctcaa |
285 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1453207 |
atcattttacacaaacttgcagaactcgtctttgtttcaagtcatctaaccggacgccgcatcgaactcatctcctcaa |
1453129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 36
Target Start/End: Complemental strand, 1453415 - 1453383
Alignment:
| Q |
4 |
tcaattttacttataatttagaacggagggagt |
36 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
1453415 |
tcaattttgcttataatttagaacggagggagt |
1453383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 109 - 285
Target Start/End: Original strand, 15899179 - 15899357
Alignment:
| Q |
109 |
agaaagagtgtccatatatgagagtgagaggaagacat--caaccgtattattaaaatgaacggatgagattaaatgatcatcacgtgctcctctattca |
206 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| ||||||||| ||||||||||| || | ||||||||||||||||| ||||||||| |||| |
|
|
| T |
15899179 |
agaaagagtgaccttatatgagagtgagaggaagacatgtcaaccgtatgattaaaatgaagggcagggattaaatgatcatcacatgctcctcttttca |
15899278 |
T |
 |
| Q |
207 |
atcactttacacaaacttgcagaactcgtctttgtttcaagtcatctaaccggatgccgcatcgaactcatctcctcaa |
285 |
Q |
| |
|
|||| ||||||||||| ||||||| | |||| ||||||||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
15899279 |
atcattttacacaaaccagcagaacccatcttcgtttcaagtcatcgaaccggctgccgcatcgaactcgtctcctcaa |
15899357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University