View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9830_low_23 (Length: 234)
Name: NF9830_low_23
Description: NF9830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9830_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 219
Target Start/End: Original strand, 9084812 - 9085013
Alignment:
| Q |
13 |
gagatgaacttataaatgttatta--ctagatgacattggtcataaccattttattaaaacatcttgaaactaattaagtaatcaattgtaggttttaga |
110 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9084812 |
gagacgaacttataaatgttattatactagatgacattggtcataaccattttattaaaacatcttgaaactaattaagtaataaattgtaggttttaga |
9084911 |
T |
|
| Q |
111 |
cacaattataaagcaatattgaaagagaaacgaaccgaacatgacctactcgttgttttgctagtatttatttcataaattgtgaatcaa-gcacaatcc |
209 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
9084912 |
cacaattataaa--------gaaagagaaatgaaccgaacatgacctactcgttcttttgctagtatttatttcataaattatgaatcaaggcacaatcc |
9085003 |
T |
|
| Q |
210 |
cccaaattta |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
9085004 |
cccaaattta |
9085013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University