View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9830_low_24 (Length: 231)
Name: NF9830_low_24
Description: NF9830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9830_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 25955937 - 25955740
Alignment:
| Q |
16 |
tagggggtattttgctgctgcagttgtcaaagattctatctatgtgattggtggtgttaatggtgatgaaaatattgtagatactgtaagtaaatctatt |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25955937 |
tagggggtattttgctgctgcagtcgtcaaagattctatctatgtgattggtggtgttaatggtgatgaaaatattgtagatactgtaagtaaatctatt |
25955838 |
T |
|
| Q |
116 |
gaccttagtcttttgcctttggttatacacttggtattaatatcacattcatattctatacttgcatatatgcacacaggtcgagagttatacggaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25955837 |
gaccttagtcttttgcctttggttatacacttggtattcatatcacattcatattctatacttgcatatatgcacacaggtcgagagttatatggaag |
25955740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University