View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9830_low_26 (Length: 216)

Name: NF9830_low_26
Description: NF9830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9830_low_26
NF9830_low_26
[»] chr5 (1 HSPs)
chr5 (1-201)||(2177195-2177394)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 2177394 - 2177195
Alignment:
1 ttgacccctaggtcacttcattgatattgagcagnnnnnnnttcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatg 100  Q
    ||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2177394 ttgacccctaggtcacttcattgatattgagcagaaaaaaattcaggtaattagtccatgaccctttgtgccccgccaccctagacatatcgatcatatg 2177295  T
101 cttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatatttttcctcaccctttcttttccttcccacttct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
2177294 cttatccttatatcatatcatatacttcataatcaactactataaattcactcttctatgtccatatttttcctcaccc-ttcttttccttcccacttct 2177196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University