View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9830_low_8 (Length: 368)
Name: NF9830_low_8
Description: NF9830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9830_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 8446056 - 8445876
Alignment:
| Q |
20 |
ctattgtggatt-ggaatactctgtctcccaaaagcgacatcgcccctgcccatgccttattcaaacttgggaccatagcatacactagtggagttccag |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446056 |
ctattgtggatttggaatactctgtctcccaaaagcgacatcacccctgcccatgctttattcaaacttgggaccatagcatacactagtggagttccag |
8445957 |
T |
|
| Q |
119 |
ggttttcattcaagattatgatagcaacaagtataaattagtaacaaaatcacttaacttggataataataattagaaggcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445956 |
ggttttcattcaagattatgatagcaacaagtataaattagtaac-aaatcacttaacttggataataataattagaaggcc |
8445876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 302 - 362
Target Start/End: Complemental strand, 8445874 - 8445814
Alignment:
| Q |
302 |
ttgtgtgtgctttagtaggcttagagcgccaaatattatagggaggttcagtctgtgctgc |
362 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445874 |
ttgtgtgtgctttggtaggcttagagcgccaaatattatagggaggttcagtctgtgctgc |
8445814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 43062010 - 43061967
Alignment:
| Q |
184 |
ataataattagaaggccaaacacaaaacaataccaaaatctaaa |
227 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43062010 |
ataataattagaagaccaaccacaaaacaataccaaaatctaaa |
43061967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University