View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9831_high_7 (Length: 302)
Name: NF9831_high_7
Description: NF9831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9831_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 36 - 209
Target Start/End: Original strand, 7501954 - 7502127
Alignment:
| Q |
36 |
taataaaaaatggtctgatggagcttagaataggtcaatatgcacaagagagcagaatcaggagatgcaattccgtttaaatcaaatgatacaagaaaat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7501954 |
taataaaaaatggtctgatggagcttagaatgggtcaatatgcacaagagagcagaatcaggagatgcaattccgattaaatcaaatgatacaagaaaat |
7502053 |
T |
|
| Q |
136 |
ctacttctgctgcacgtagagttacaaagaagaaaggtgggggttacttgcatcattgtgctcaacgtttgaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7502054 |
ctacttctgctgcacgtagagttacaaagaagaagggtgggggttatttgcatcattgtgctcaacgtttgaag |
7502127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 153 - 270
Target Start/End: Complemental strand, 21582772 - 21582655
Alignment:
| Q |
153 |
agagttacaaagaagaaaggtgggggttacttgcatcattgtgctcaacgtttgaagcatattgcgtgactttctgacgcagatcgaaaggaagtgctcc |
252 |
Q |
| |
|
|||||| |||| ||||| |||||||||||||||| ||| ||||| | || ||||| ||||||||| | || ||||||| ||| ||||||||||||| | |
|
|
| T |
21582772 |
agagtttcaaacaagaagggtgggggttacttgcgtcactgtgcccgtcggttgaaacatattgcgcgtctccctgacgctgatagaaaggaagtgcttc |
21582673 |
T |
|
| Q |
253 |
gtgctttgcgtaagacta |
270 |
Q |
| |
|
| ||||| |||||||||| |
|
|
| T |
21582672 |
gcgctttacgtaagacta |
21582655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University