View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9831_low_10 (Length: 266)
Name: NF9831_low_10
Description: NF9831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9831_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 34877619 - 34877861
Alignment:
| Q |
15 |
ataggtttcggggtttgcaaaggctatgatgagacatgctaccaaggttgaaggtttggttgatgtggttgacattgttggtactggaggggatggtgca |
114 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34877619 |
ataggtttcggggttggcaaaggctatgatgagacatgctaccaaggttgaaggtttggttgatgtggttgacattgttggtactggaggggatggtgca |
34877718 |
T |
 |
| Q |
115 |
aacaccgttaatatttcaacggggtcttccattcttgctgctgcctgtggtgtaaaagtcgcaaaggtgtgnnnnnnnnnnnnnnnnattatggattgaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34877719 |
aacaccgttaatatttcaacggggtcttccattcttgctgctgcctgtggtgtaaaagtcgcaaaggtgtg---ttttttttttttcattatggattgaa |
34877815 |
T |
 |
| Q |
215 |
agttgagagtttttgtaattgtgtgtgatgaatttgattcttctct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34877816 |
agttgagagtttttgtaattgtgtgtgatgaatttgattgttctct |
34877861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University