View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9831_low_11 (Length: 235)
Name: NF9831_low_11
Description: NF9831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9831_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 31578839 - 31579029
Alignment:
| Q |
19 |
ctattcagttacgatgacgcataacacttattagaaatgatctcaacgatcacttcggtgaaaatagcaacaaattggagcgtattcaaatcagattact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
31578839 |
ctattcagttacgatgacgcataacacttattagaaatgatctcaacgatcacttcggtgaaaatagcaacaaattggaacgtatttaaattagattact |
31578938 |
T |
|
| Q |
119 |
ttataaataggggttcaccccatatatgattactcgataaccaactcacttatttgctatatgctcacacctactttattttaacaccaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31578939 |
ctataaataggggttcaccccatatatgattactcgataaccaactcacttatttgctatatgctcacacctactttattttaacaccaaa |
31579029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University