View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9832_high_6 (Length: 211)
Name: NF9832_high_6
Description: NF9832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9832_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 32350806 - 32350986
Alignment:
| Q |
15 |
ggacgttggtgggttgctatagttcgatcaataataggtatagacatacctatatggttagcctttcatgtcttgtttcttcatcnnnnnnngcgaacta |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32350806 |
ggacattggtgggttgctatagttcgatcaataataggtatagacatacctatatgtttagcctttcatgtcttgtttcttcatcaaaaaaagcgaacta |
32350905 |
T |
|
| Q |
115 |
aatacaaatgacatgcctttatcctttattctcatgtctcttggcccttaatacgaataatcaatcatccatcgtaatcat |
195 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350906 |
aatacaaatgacatgcctctatcctttattctcatgtctcttggcccttaatacgaataatcaatcatccatcgtaatcat |
32350986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University