View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9832_low_15 (Length: 238)
Name: NF9832_low_15
Description: NF9832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9832_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 20528009 - 20527803
Alignment:
| Q |
19 |
ttatttcgaaaggggtgttcggagacatctgagagtcaaatgaatcggaaaacgatttatttacaaaaagacaatttgtggggaaggtgtgccacaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20528009 |
ttatttcgaaaggggtgttcggagacatctcagagtcaaatgaatcggaaaacgatttacttacaaaatgacaatttgtggggaaggtgtgccacaaaaa |
20527910 |
T |
 |
| Q |
119 |
att-aggaggattagaatactaaaactcttgtctggagagatatgttaatcgttgaagtgaattatagctccactacgaaggggtaaaggtagtgaggga |
217 |
Q |
| |
|
||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20527909 |
atttaggtggattagaatactaaagctcttgtctggagagatatgttaatcgttgaagtgctttatagctccactacgaaggggtaaaggtagtgaggga |
20527810 |
T |
 |
| Q |
218 |
ttcaaat |
224 |
Q |
| |
|
||||||| |
|
|
| T |
20527809 |
ttcaaat |
20527803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University