View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9832_low_17 (Length: 236)
Name: NF9832_low_17
Description: NF9832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9832_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 20749993 - 20750214
Alignment:
| Q |
1 |
tcccttattcacaaaacacccttgtttcacggttgtcaaaccaaattccacttcatataattaattatactctccacctttgtgcctcctcgaagaaaat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20749993 |
tcccttattcacaaaacaaccttgtttcacggttgtcaaaccaaattccacttcatataattaattatactctccacctttgtgcctcctcgaagaaaat |
20750092 |
T |
 |
| Q |
101 |
ctctttgaattctcagaatcttcttatgtacctttattgacaacttcnnnnnnnnnnnnnnnnnnnnttagcatcaacgactgttacatgggttaaagca |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20750093 |
ctctttgaattctcagaatcttcttctgtacctttattgacagcttcaaaaaagaaagataaaaaaattagcatcaacgactgttacatgggttaaagca |
20750192 |
T |
 |
| Q |
201 |
caagatagcatacaaagagtga |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
20750193 |
caagaaagcatacaaagagtga |
20750214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University