View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9832_low_22 (Length: 225)
Name: NF9832_low_22
Description: NF9832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9832_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 51196384 - 51196574
Alignment:
| Q |
16 |
atgaagaaaggagaatgttcaaactttttagaaaaatacactatcaatttattgactttttgaatagttggttaattatgctcttgtatcaacggttatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51196384 |
atgaagaaaggagaatgttcaaactttttagaaaaatacactatcaatttattgactttttgaatagttggttaattatgctcttgtatcaacggttatg |
51196483 |
T |
|
| Q |
116 |
gttattctcatcacttgcaattatttttattaatccataacaacatacaaagagaaacactatgaatcttaaaatccatgaacaaaaggat |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51196484 |
gttattctcatcacttgcaattattgttattaatccataacaacatacaaagagaaacactatgaatcttaaaatccatgaacaaaaggat |
51196574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University