View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9832_low_26 (Length: 206)
Name: NF9832_low_26
Description: NF9832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9832_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 45 - 196
Target Start/End: Original strand, 52873452 - 52873603
Alignment:
| Q |
45 |
gcactgcagttatctggatcagttgctgtttgtgttcgtggtaactgcgactacacaactaaagctacattatcacagtcagtgggtgctactgctgtgt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873452 |
gcactgcagttatctggatcagttgctgtttgtgttcgtggtaactgcgactacacaactaaagctacattatcacagtcagtgggtgctactgctgtgt |
52873551 |
T |
|
| Q |
145 |
tgatgataaatgagagtaacttccccacccatacatcccattcatctcactc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52873552 |
tgatgataaatgagagtaacttccccacccatacatcccattcatttcactc |
52873603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University